Small molecule inhibitor of TLR4 inhibits ovarian cancer cell proliferation: new insight into the anticancer effect of TAK‑242 (Resatorvid)

Bahareh Kashani1,2 · Zahra Zandi1,2 · Davood Bashash3 · Azam Zaghal1 · Majid Momeny4 · Ensieh M. Poursani1 · Atieh Pourbagheri‑Sigaroodi1 · Seyed A. Mousavi1 · Seyed H. Ghaffari1

Abstract
Background Despite all advances in the treatment of ovarian cancer (OC), it remains the most lethal gynecological malig- nancy worldwide. There are growing amounts of evidence indicating the role of inflammation in initiating chemoresistance. Therefore, Toll-like receptor 4 (TLR4), a mediator of inflammation in cancer cells, may be a proper anticancer target.
Methods The effects of TLR4 activation by LPS was studied using MTT, colony formation, staining, scratch, and qRT-PCR assays as the first step. Then the same assays, in addition to anoikis resistance, cell cycle and annexin V/PI apoptosis tests, were used to investigate whether the inhibition of TLR4 using a small molecule inhibitor, TAK-242, could suppress the proliferation of various OC cell lines: A2780CP, 2008C13, SKOV3, and A2780S.
Results The activation of TLR4 using LPS showed enhanced proliferation and invasion in the TLR4-expressing cell line
(SKOV3). Next, treatment with the inhibitor revealed that TAK-242 suppressed the inflammatory condition of ovarian cancer cells, as evident by the down-regulation of IL-6 gene expression. We also found that TAK-242 halted cancer cell proliferation by inducing cell cycle arrest and apoptosis through the modulation of genes involved in these processes. Given the fact that the overexpression of TLR4 contributes to drug resistance, it was tempting to investigate the effect of TAK-242 in a combined- modality strategy. Interestingly, we found enhanced cytotoxicity when TAK-242 was used in combination with doxorubicin. Conclusion TAK-242 serves as an appealing therapeutic strategy in the TLR4-expressing OC cells, either in the context of monotherapy or in combination with a chemotherapeutic drug.
Keywords Toll-like receptor 4 (TLR4) · TAK-242 · Resatorvid · LPS · Ovarian cancer · Targeted therapy

Bahareh Kashani and Zahra Zandi contributed equally to this work as first authors.

Seyed H. Ghaffari
[email protected]; [email protected]
1 Hematology, Oncology and Stem Cell Transplantation Research Center, Shariati Hospital, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran
2 Department of Medical Genetics, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran
3 Department of Hematology and Blood Banking, School of Allied Medical Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Iran
4 Turku Centre for Biotechnology, University of Turku and Åbo Akademi University, Turku, Finland

Introduction
Ovarian cancer (OC), which is the seventh most prevalent cancer and the first fatal gynecological malignancy among women, is mostly associated with poor prognosis when diag- nosed at late stages [1]. The main obstacle in diagnosis is the lack of early detection methods and the overlap of OC symptoms with digestive difficulties, which makes detec- tion even more complicated [2]. Another problematic aspect concerning this malignancy is the acquisition of chemore- sistant phenotype upon long-term treatment with first-line drugs such as paclitaxel and cisplatin [3–5]. Overcoming this hindrance remains one of the main complications for the patients and a growing body of literature has focused on this matter, many of which have introduced inflamma- tion as an important stimulatory factor [6–8]. Activation of the innate immune system receptors in cancer cells and

subsequent accumulation of pro-inflammatory cytokines in the tumor microenvironment are major culprits of can- cer progression [9]. There are 11 different members of the toll-like receptor (TLR) family present in humans, each of which is activated by several specific exogenous (PAMPs) or endogenous (DAMPs) ligands [10]. Toll-like receptor 4 (TLR4) is often overexpressed on the surface of cancer cells including OC, providing an advantage in gaining chemore- sistance characteristics and developing angiogenesis [11]. Interestingly, it has been demonstrated that not only can paclitaxel directly activate TLR4 [12], but also treatment with any chemotherapeutic agent or radiotherapy results in dissemination of endogenous ligands known as “alarmins”
[13] (e.g., Heat shock proteins, HMGB1, etc. [14, 15]) from the damaged cells, leading to enhanced activity of TLR4 [16]. Once activated, TLR4 can recruit two different adap- tor proteins that both aim to activate NF-кB: TRAM is the adaptor that recruits TRIF and starts MyD88-independent (non-canonical) pathway which later results in type I inter- ferons (IFNs), e.g., IFNβ secretion [17]. The other adaptor protein, TIRAP, initiates the MyD88-dependent (canonical) pathway that is responsible for stimulating the production of different interleukins [18], which is followed by a local and later systemic inflammation [19]. Inflammatory cytokines enter the bloodstream that results in an “autocrine-tumor protective loop” [20]. In other words, tumor cells produce alarmins to activate the immune system; however, they end up providing metastasis-prone sites, especially in the bone marrow and the lungs [16].
Successful drug design has yielded different classes of selective inhibitors of TLR4, among which TAK-242 (ethyl (6R)-6-[N-(2-chloro-4-fluorophenyl) sulfamoyl] cyclohex- 1-ene-1-carboxylate) is a promising bioavailable TLR4 inhibitor with an extensive anti-inflammatory effect. This small molecule selectively binds to Cys-747 in the TIR (Toll/IL-1 receptor) domain of the intracellular domain of the receptor, which in turn hinders the downstream adap- tor proteins (TRAM and TIRAP) from binding to TLR4 to totally suppress the pathway [21–23]. TAK-242 has been successfully examined for sepsis shock [24], lung injury [25], kidney injury [26] and asthma [27] treatment, aldos- terone-induced cardiac and renal injury prevention [28], and suppression of UV-induced skin tumors [29]. However, to the best of our knowledge, this inhibitor has never been used as an anticancer agent for OC treatment. In this study, we investigated for the first time the effects of TLR4 inhibition on the survival of OC cell lines, which delineated that TAK- 242 is an appealing anticancer agent, either singularly or in combination with a common chemotherapeutic agent.

Materials and methods
Human ovarian cancer (OC) cell lines and chemicals

A2780CP, OVCAR3, A2780S, 2008C13, SKOV3, and
CAOV4 (OC cell lines) were purchased from the National Cell Bank of Iran (NCBI; Tehran, Iran). All cell lines were maintained at 37 °C in 5% CO2 in a humidified incubator and cultured according to NCBI recommendations, using RPMI with 10% of fetal bovine serum (FBS) and 1% Pen-Strep. All cell lines were screened for mycoplasma infection. LPS was purchased from InvivoGen (San Diego, CA, USA) and toll-like receptor inhibitor (TAK-242) was purchased from Calbiochem (San Diego, CA, USA); both were preserved in − 20 °C. Poly-hydroxyethyl methacrylate polymer (Poly HEMA) was purchased from Santa Cruz Biotechnology.

Crystal violet staining

About 1.5 × 103 cells were plated in 24-well plates and treated after 24 h with concentrations of 35, 75, and 100 µM of TAK-242 or 10 µM of LPS. After 48 h, cells were fixed with ice-cold methanol and stained with crys- tal violet (0.5%w/v). Wells were photographed under an inverted microscope.

Investigating the basal expressions of TLR4‑associated genes using PCR

OC cell lines were harvested from cell culture flasks and RNA was extracted using RNX plus TRIzol protocol (SinaClon BioScience, Tehran, Iran). PrimeScript Rea- gent Kit (TaKaRa Bio INC, Japan) was used for cDNA synthesis on Applied Biosystems 96-well thermal cycler. Amplification involved 3 min in 95 °C for enzyme activa- tion followed by 35 cycles including 95 °C for 30 s, 60 °C for 25 s, and 72 °C for 30 s and a final 72 °C for 7 min. TLR4, MyD88, NF-кB1, and RELB genes were amplified using the primers listed in Table 1. PCR products were then visualized on 1.5% agarose gel.

MTT assay

OC cells were seeded onto 96-well plates (about 2.5 × 103 cells per well) and incubated for 24 h at 37 °C and then treated with different concentrations of TAK-242 or LPS for 48 h. The percentages of viable cells were analyzed by MTT assay afterward. The results were collected using an ELISA reader (Power wave XS2-BioTek) at 570 nm wavelength.

Table 1 Nucleotide sequences of primers used for RT-PCR and real-time PCR

Gene Accession number Forward primer (5’→3’) Reverse primer (3’→5’) Size (bp)
B2M NM_004048.3 GATGAGTATGCCTGCCGTGT CTGCTTACATGTCTCGATCCCA 79
TLR4 NM_138557.2 AGACCTGTCCCTGAACCCTAT CGATGGACTTCTAAACCAGCCA 147
MyD88 NM_001172567.1 CATATGCCTGAGCGTTTCGATG CGTGGCCTTCTAGCCAACCT 197
NF-ĸB1 XM_024454069.1 AGAAGTCTTACCCTCAGGTCAAA TCCAGCAGTTACAGTGCAGAT 152
RELB XM_005259127.3 TTCCGAGCCCGTCTATGACAA TGAACACCACTGATATGTCCTCT 149
IL-2 XM_017008177.1 GCACTAAGTCTTGCACTTGTCA AATGCTCCAGTTGTAGCTGTG 79
IL-6 XM_005249745.5 ACTCACCTCTTCAGAACGAATTG CCATCTTTGGAAGGTTCAGGTTG 149
VEGFA NM_001287044.1 AGGCCAGAATCATCACGAAGT AGGGTCTTGATTGGATGGCA 75
KDR NM_002253.3 GGCCCAATAATCAGAGTGGCA CCAGTGTCATTTCCGATCACTTT 109
TP53 NM_001126118.1 TCAACAAGATGTTTTGCCAAC ATGTGCTGTGACTGCTTGTAGATG 118
CDKN1A (p21) NM_000389 CCTGTCACTGTCTTGTACCCT GCGTTTGGAGTGGTAGAAATCT 130
CDK1 XM_005270303.3 AAACTACAGGTCAAGTGGTAGC ATCCTGCATAAGCACATCCTGA 149
CDK2 XM_011537732.2 CCAGGAGTTACTTCTATGCCTGA TTCATCCAGGGGAGGTACAAC 90
CCNB1 NM_001354844.1 AATAAGGCGAAGATCAACATGGC TTTGTTACCAATGTCCCCAAGAG 111
GADD45A NM_001924.3 GAGAGCAGAAGACCGAAAGGA CACAACACCACGTTATCGGG 145
WEE1 NM_003390.4 AGGGAATTTGATGTGCGACA CTTCAAGCTCATAATCACTGGT 160
Survivin NM_001012270.1 CCACCGCATCTCTACATTCA TTTCCTTTGCATGGGGTC 184
BCLxL XM_011528964.2 GAGCTGGTGGTTGACTTT TCCATCTCCGATTCAGTC 119
BAD NM_032989.2 CCCAGAGTTTGAGCCGAGTG CCCATCCCTTCGTCGTCCT 249
CASP9 XM_011542273.3 GCTTCGTTTCTGCGAACTAACA GTTGGCTTCGACAACTTTGCT 50

Anoikis resistance assay

Each well of 96-well plate was covered with 50 ml of Poly HEMA solution to stimulate anoikis condition and the plate was left to dry for 24 h. About 8 × 103 cells were plated and treated with different concentrations of TAK- 242 simultaneously. After 48 h of incubation, plates were centrifuged at 200 RCF for 10 min and then cell prolifera- tion was measured by MTT assay. Next, cells were seeded onto poly HEMA-covered six-well plates. After 48 h, only anoikis-resistant cells survived which were used for RNA extraction, cDNA synthesis, and qRT-PCR to evaluate the effect of TAK-242 on the gene expression of these cells.

Colony formation assay

About 500–1000 cells were seeded in each well of 24-well plates and treated with TAK-242 or LPS after 24 h. Drug- containing media was replaced with the drug-free one after 48 h of incubation. Plates were incubated until suitable sizes of colonies were observed (5–7 days depending on the cell lines). They were then fixed with ice-cold metha- nol and stained with crystal violet solution (0.5%w/v). Colonies were counted and the surviving fractions (SF) were estimated as:

SF = mean colony counts of treated well. mean colony count of control well

Scratch assay

Cells (25 × 105) were seeded in 24-well plates to reach 80–90% confluency. After 24 h, a scratch was made and then cells were treated with 10 µM of LPS. The first photographs were taken immediately after treatment. 48 h later, another photograph was taken to show the width of the scratch to investigate the effects of LPS on cell migration.

Cell cycle analysis

About 5 × 104 cells were plated in 12-well plates and incu- bated for 48 h after TAK-242 treatment. Harvested cells were washed in ice-cold PBS, fixed in 70% ethanol, and stored at − 20 °C overnight. RNase A (100 μg/ml) (Sigma), PI (propidium iodide,50 μg/ml) (Sigma), and 0.05% Triton X-100 were then added to cell plates and further incubated for 15 min. FACSCalibur (BD Bioscience, San Jose, CA, USA) flow cytometer equipped with CellQuest Pro software was used for cellular DNA analysis.

Annexin V/PI apoptosis test

Apoptosis induction ability of TAK-242 was measured using propidium iodide (PI) and annexin V-FITC (Thermo Fisher Scientific, USA). About 5 × 104 cells were seeded onto 12-well plates and the protocol described by the kit manual was carried out. The cell death rates were obtained using the Partec PAS III flow cytometer (Partec GmbH) and WindowsTM FloMax software (Partec).
Gene expression investigation using quantitative reverse transcription‑PCR (qRT‑PCR)

About 105 cells per well were seeded onto 12-well plates and treated with LPS or TAK-242 for 48 h. Next, cells were harvested and RNA extraction and cDNA synthesis were performed as previously described. The thermal cycling conditions for qRT-PCR on the LightCycler® 96 instrument involved an activation step for 15 min at 95 °C, followed by 40 cycles of denaturation step (15 s at 95 °C) and a combined annealing/extension step for 1 min at 60 °C. To normalize expression levels, B2M (beta-2-microglobulin) was used as the housekeeping gene. For basal expression evaluation, mRNA expression was quantified using the ΔΔCT method against the highest TLR4-expressing cell line (A2780CP). For relative gene expression after the treatment, the results were quantified against the untreated control cells. The list of the used primers is shown in Table 1.
Statistical analysis

All data were evaluated in triplicate against untreated control cells and collected from three independent experi- ments. Data were analyzed using one-way ANOVA and the unpaired two-tailed Student’s t test and graphed by Graph- Pad Prism Software 7.04. The same program was used for P value calculation. All data are presented as mean ± standard deviation (SD).

Results
TAK‑242 affects cell proliferation and morphology of OC cell lines

Due to mounting evidence suggesting inflammation as an underlying cause of ovarian cancer and the fact that toll- like receptor 4 is a major member of pattern recognition receptors, it was tempting to determine the effects of TLR4 inhibition using TAK-242 on the viabilities and morpholo- gies of a panel of epithelial OC cell lines by a visual crystal violet staining assay. As represented in Fig. 1a, TAK-242 affected almost all cell lines in a concentration-dependent

manner, but not all the cells responded equally. Interest- ingly, the results of RT-PCR demonstrated that different OC cells possessed different expression levels of TLR4 and its downstream genes MyD88, NF-ĸB1, and RELB (Fig. 1b). According to the results of qRT-PCR that confirmed the pre- vious data (Fig. 1c), four cell lines with high (A2780CP), middle (2008C13), low (SKOV3), and negligible (A2780S) TLR4 expression were selected for further investigations in this study.
TAK‑242 inhibits the survival of OC cells

Based on the inhibitory effect of TAK-242 evident from the crystal violet staining test, an MTT assay was per- formed with increasing concentrations of the inhibitor on the selected cell lines. As depicted in Fig. 2a, our results showed that TAK-242 attenuated the survival of the cells with IC50 values ranging from 62 µM (SKOV3) to 216 µM (A2780S). Notably, A2780S cells, the least responsive cell line to TAK-242, represented negligible levels for all the TLR4-related genes which suggests the low off-target effect of the inhibitor. The correlation analysis between the basal expression levels of the TLR4 pathway genes and the drug IC50 values for the TLR4-expressing cell lines showed a significant correlation (r = 0.9951, P = 0.0447) for TLR4; no correlations were detected for other genes. Interestingly, the results of MTT assay in an anoikis-inducing condition showed that TAK-242 could also suppress the survival of anoikis-resistant cells, as the major culprits of metastasis induction (Fig. 2b). In harmony, qRT-PCR revealed that this suppression was coupled with the up-regulation of BAD, an anoikis marker gene. Based on the effect of TAK-242 on anoikis-resistant cells, which are prone to form colonies in distinct sites, it was also tempting to study its effect on the clonogenic ability of the OC cells. Our results confirmed that the colony formation ability of the cells was inhibited in a concentration-dependent manner with the lowest effect on A2780S (Fig. 2c). Taken together, our results suggest that the expression of toll-like receptor 4 and its signaling path- way could be an underlying cause of excessive proliferation in OC cell lines.
TLR4 activation using LPS induces proliferative responses in the TLR4‑expressing OC cells

Next, to approve the proliferative effect of the TLR4 signal- ing on OC cells, we selected SKOV3 and A2780S cells for the treatment with LPS as the main ligand of TLR4. Firstly, cells were treated with different concentrations of LPS and an MTT assay was performed. Noteworthy, the results indi- cated that the TLR4 activation with 10 µM of LPS induced proliferation in the TLR4-expressing SKOV3 cells (Fig. 3a). As represented in this figure, A2780S was not responsive

Fig. 1 TAK-242 inhibits proliferation and causes morphological changes in different OC cells. a The results of the crystal violet stain- ing assay showed a concentration-dependent effect of TAK-242 on cell proliferation and morphology of OC cell lines. Basal expression levels of four important genes (TLR4, MyD88, NF-ĸB1, and RELB) involved in the TLR4 pathway were investigated by both PCR (b) and

qRT-PCR (c). While A2780S had negligible expression, A2780CP showed the highest expression of all genes. Quantitative RT-PCR results were normalized relative to the most TLR-expressing cell line (A2780CP). Data are shown as mean ± SD from three independent experiments

to the treatment with LPS. Besides, the results of crystal violet staining, colony formation, and scratch assays further confirmed that the TLR4 activation using LPS induced both proliferation and invasion in the TLR4-expressing SKOV3 cell line (Fig. 3b, c, d). Furthermore, the results of qRT- PCR showed that following the treatment of SKOV3 cells with 10 µM of LPS, TLR4 pathway-related genes (TLR4, MyD88, and NF-ĸB1) and their downstream targets (IL- 2, IL-6, VEGFA, and KDR) were up-regulated, however, A2780S cells were not responsive to the treatment (Fig. 3e).
TAK‑242 modulates cell cycle and induces apoptosis in OC cells

Based on a fine-tuned cross talk between TLR4 and NF-ĸB and given the fact that NF-ĸB is a significant regulator of cell cycle and apoptosis, it was intriguing to investi- gate whether the TLR4 inhibition using TAK-242 could affect either cell cycle or apoptosis in OC cells. Cell cycle

analysis revealed that the TLR4-expressing cell lines showed variations in the distribution of the cells in differ- ent phases. As depicted in Fig. 4a, A2780CP had elevated levels of sub-G1 and SKOV3 showed G2/M cell cycle arrest, while 2008C13 cells showed both enhanced sub- G1 and G2/M arrest after treatment with TAK-242; on the other hand, A2780S did not seem to be much affected. Motivated by the increased number of cells in the sub-G1 phase, an annexin V/PI apoptosis test was also performed to quantitatively evaluate whether TAK-242 exerts its effect through the induction of apoptotic cell death. Our results showed that A2780CP and 2008C13 were the most affected cells which showed 36% and 24% early and 33% and 45% late apoptosis, respectively. Furthermore, SKOV3 had 4% early and 27% late apoptosis, whereas A2780S was affected the least (15% early and 10% late apoptosis). Finally, it is worthy to note that the variations in necrotic cells were negligible (Fig. 4b).

Fig. 2 TAK-242 inhibits cell survival and clonogenic ability of OC cells. a MTT assay showed a concentration-dependent effect of TAK- 242 on cell survival, with A2780S being the most resistant cell line. b MTT assay in an anoikis-inducing condition also showed that the sur- vival of anoikis-resistant cells was inhibited, which was coupled with increased expression of BAD gene (BAD expression was not detected in anoikis-resistant A2780S cells). c The colony formation ability of

neoplastic cells was significantly inhibited after TAK-242 treatment. The surviving fractions were calculated related to the untreated con- trol groups. Data are shown as mean ± SD from three independent experiments. Statistically significant values of *P < 0.05, **P < 0.01, and ***P < 0.001 are determined compared to the untreated control group

TAK‑242 alters the expression levels of cell cycle‑ and apoptosis‑related genes in OC cells

To delve into the molecular mechanisms by which TAK- 242 affects the survival of OC cells, the mRNA expressions of three different groups of genes involved in the TLR4 pathway and inflammation (Fig. 5a), cell cycle regulation (Fig. 5b), and those associated with the apoptosis mecha- nisms (Fig. 5c) were investigated using qRT-PCR. The resulting data showed that the inhibitory effect of TAK-242 on NF-ĸB1 and IL-6 was coupled with the down-regulation of genes involved in cell cycle regulation (CDK1, CDK2, and CCNB1). Accordingly, we found that TAK-242 also increased the mRNA levels of TP53, CHEK1, CDKN1A (p21), GADD45A, and WEE1, which was in agreement with the induction of G2/M arrest in the TLR4-expressing cells. Pro-apoptotic (BAD and Casp9) and anti-apoptotic (survivin

and BCLxL) genes were affected in the TLR4-expressing cell lines as well, shedding light on the apoptotic effect of the inhibitor on the OC cells expressing TLR4.
TAK‑242 intensifies the sensitivity of OC cells to doxorubicin

Growing pieces of evidence have recently suggested that the overexpression of TLR4 could serve as a chemoresistance marker in different human malignancies. Moreover, doxoru- bicin has been known to induce different heat shock proteins (HSPs) that serve as ligands of TLR4 [30–32]. Given these facts and based on the significant role of TLR4 expression in OC cells resistance to doxorubicin, it was fascinating to investigate whether TAK-242 could intensify the cytotoxicity of doxorubicin in the TLR4-expressing cell lines. The results of the MTT assay showed that the treatment of OC cells with

Fig. 3 TLR4 activation using LPS, induces proliferation and invasion in the TLR4-expressing cell line (SKOV3). The results of MTT (a), colony formation (b), and crystal violet staining (c) assays indicated that LPS treatment of SKOV3 cells resulted in excessive proliferation. Scratch assay also showed enhanced invasion induced by LPS in the same cell line (d). The cell line with negligible TLR4-expression (A2780S) was not responsive to either assay. e Gene expression analysis revealed that LPS-induced proliferation in SKOV3 was coupled with the up-regulation of downstream genes of the TLR4 pathway (MyD88, NF-κB1, IL-2, IL-6, VEGFA, and KDR). Data are shown as mean ± SD from three independent experiments. Levels of expression were nor- malized to the untreated cells. Statistically significant values of *P < 0.05, **P < 0.01, and ***P < 0.001 are determined compared to the untreated control group

Fig. 4 TAK-242 alteres distribution of the cells in different phases of cell cycle and induced apoptosis in OC cell lines. a TAK-242 induced G2/M arrest and also increased sub-G1 in OC cells. A2780S was the least affected cell line probably due to the slightest expression of

TLR4. b Apoptosis was induced in all the tested cells after TAK-242 treatment; A2780CP and 2008C13 had about 70% apoptotic cells, yet the proportion was about 25% in A2780S different concentrations of doxorubicin in combination with 40 µM of TAK-242 led to superior cytotoxicity compared to each drug individually (Fig. 6). Taken together, the results of our synergistic experiments suggest that TAK-242 may serve as a novel promising adjuvant in combination treatment of ovarian cancer cells, especially for those with overexpression of TLR4.

Discussion
Ovarian cancer is the most lethal gynecological cancer worldwide, mostly due to the lack of specific symptoms and proper detection methods at early stages [33]. There are increasing lines of evidence suggesting that the high

Fig. 5 TAK-242 treatment modulates the mRNA expressions of dif- ferent genes. The selected genes were categorized into three groups: TLR4 pathway-related (a), cell cycle regulatory (b), and apoptosis-

related (c) genes. The results indicated that most of the genes were altered in the TLR4-expressing cell lines

metastasis rate of ovarian cancer may be owing to chronic inflammation [34], which proposes inflammation-related signaling pathways as appealing targets for cancer treat- ment strategies. Toll-like receptor 4 (TLR4), which is an important member of pattern recognition receptors and

serves as a key contributor to inflammation [35], has recently drawn scientists’ attention in cancer studies. In this study, we found that TLR4 activation using LPS, as revealed by the up-regulation of the TLR4 pathway- related genes, led to the proliferation and invasion of the

Fig. 6 TAK-242 enhances the sensitivity of the TLR4-expressing OC cells to doxorubicin treatment. The synergistic effect of the TLR4 inhibition using TAK-242 on doxorubicin cytotoxicity was determined using MTT assay. Values are given as mean ± SD of

three independent experiments. Statistically significant values of
*P < 0.05, **P < 0.01 and ***P < 0.001 are determined compared to the untreated control group

Fig. 7 Schematic representation proposed for the mechanisms of TLR4 in OC cells. a The activation of TLR4 using LPS, as evident by the up-regulation of pro-inflammatory cytokines (IL-2, IL-6, and IL-8) and genes involved in angiogenesis (VEGFA and KDR), leads

to OC cell proliferation. b The inhibition of TLR4 using TAK-242 leads to the suppression of the TLR4-expressing OC cell progression through modulating inflammatory, apoptotic, and cell cycle-regula- tory genes

TLR4-expressing SKOV3 cell line (Fig. 7a), which is in agreement with a previous study conducted by Szajnik et al. [12]. Although multiple lines of evidence have inves- tigated the effectiveness of specific inhibitors of TLR4 as anti-inflammatory agents in clinical trials, further stud- ies are now underway to ascertain the anti-tumor effect of these inhibitors [36, 37]. For the nonce and among the multitude TLR4 inhibitors, intense interest has been

focused on the small molecule inhibitor TAK-242, which specifically inhibits the intracellular domain of TLR4 [24]. Our results outlined that while the TLR4 inhibition using TAK-242 had desirable cytotoxicity on ovarian cancer cell lines with overexpressed TLR4, it merely induced a cyto- toxic effect on a cell line with a rare expression of TLR4 (A2780S), casting light on the therapeutic application of the inhibitor against the TLR4-expressing tumor cells.
We also found that the TLR4 inhibition drastically reduced the clonogenic ability of these cells and also the proliferation of anoikis-resistant stem-like ovarian cancer cells which pos- sess the ability to invade distant sites and cause metastasis. In a recent study, it has been reported that TAK-242 could considerably decrease the invasion properties of ovarian and breast cancer cell lines through the inhibition of both extracellular matrix degradation and epithelial–mesenchy- mal transition (EMT) [38]. By investigating the molecular responses of the cells to the TLR4 inhibition (Fig. 7b), we found that TAK-242 may inhibit the inflammation-related pathways in ovarian cancer cells, suggested by the suppres- sion of IL-6 gene expression. Consistently, the role of TLR4 inhibition in the suppression of NF-ĸB-related inflamma- tion in ovarian cancer has been investigated in many recent studies. For instance, Liu et al. reported that the inhibition of the TLR4/MD2 pathway using atractylenolide I led to significant down-regulation of NF-ĸB and related inflam- matory cytokines and consequently reversed the relevant immunosuppression [39]. Furthermore, it has been reported that melatonin was able to suppress the TLR4 pathway and in turn led to the suppression of pro-inflammatory cytokines and interferons in an in vivo model of ovarian cancer [40]. All in all, our results suggest for the first time that TAK-242 suppresses ovarian cancer cell proliferation and may exert its effect through the down-regulation of inflammation-related molecules, as suggested by previous studies that these mol- ecules are involved in tumor growth, cancer progression, and metastasis [41, 42].
According to concrete evidence which has investigated
the role of TLR4 in cell cycle progression [43–45], we assumed that TAK-242 may administer its antiprolifera- tive effect through cell cycle disruption. Cell cycle analysis revealed that sub-G1 and/or G2/M arrest was induced in the TLR4-expressing cell lines upon treatment with TAK- 242, which was in agreement with the up-regulation of p53 and p21 mRNA levels. Recently, it was shown that a plant- derived TLR4 antagonist could induce p53 and p21 in a liver fibrosis cell line and led to the induction of G2/M cell cycle arrest and apoptosis [46]. Intriguingly, our result showed that TAK-242 not only affected p53 and p21, but also modulated positive and negative regulators of mitosis entry, including GADD45A and WEE1. In search of other probable mecha- nisms by which TAK-242 may function, an apoptosis assay was also carried out. Notably, TAK-242 induced conspicu- ous apoptosis in the TLR4-expressing cell lines probably through the down-regulation of anti-apoptotic genes, such as BCLxL and survivin, as well as the up-regulation of pro-apoptotic targets including BAD and caspase 9. The observed alterations in the expression of these genes may be through the down-regulation of NF-ĸB caused by TLR4 inhibition. The protective effect of NF-ĸB against apopto- sis has been studied by a myriad of researches [47] and its

inhibition has been reported to modulate different members of the BCL2 family to induce apoptosis [48]. Moreover, TLR4 also induces TNF-α transcription which leads to higher NF-кB activation [18] and subsequently resistance to apoptosis through transcription of BCLxL and BCL2 [49, 50]. In sum, TAK-242-induced apoptosis may be due to sup- pression of NF-кB and TNF-α.
Finally, based on a previous study which showed that the production of pro-inflammatory cytokines leads to tumor protection from the anticancer effect of chemotherapeutic drugs [51], we examined the effect of TAK-242 in combina- tion with doxorubicin. We found that lower concentrations of doxorubicin combined with TAK-242 caused a synergistic anticancer effect and provided enhanced therapeutic efficacy. In conclusion, our results indicated that TLR4 activation in ovarian cancer cells contributes to the induction of inflam- mation-related molecules, such as interleukins, and in turn cancer cell proliferation. Therefore, TLR4 inhibition using TAK-242 was shown to serve as an appealing therapeutic strategy in ovarian cancer cells, either in the context of mon- otherapy or in combination with the chemotherapeutic drug. Nevertheless, more in vitro and in vivo studies are needed to confirm the results of this study and to pave the way for possible clinical trials in the foreseeable future.

Funding This work is supported by a grant from Hematology, Oncol- ogy and Stem Cell Transplantation Research Center, Tehran University of Medical Sciences, Tehran, Iran.

Compliance with ethical standards

Conflict of interest The authors declare that they have no competing interests.

References
1. Pavlov MJ et al (2018) Cytoreductive surgery and hyperthermic intraperitoneal chemotherapy for the treatment of advanced epi- thelial and recurrent ovarian carcinoma: a single center experi- ence. Int J Hyperth 34(5):564–569
2. Ryerson AB et al (2007) Symptoms, diagnoses, and time to key diagnostic procedures among older US women with ovarian can- cer. Obstet Gynecol 109(5):1053–1061
3. Shah MM, Landen CN (2014) Ovarian cancer stem cells: are they real and why are they important? Gynecol Oncol 132(2):483–489
4. Beaufort CM et al (2014) Ovarian cancer cell line panel (OCCP): clinical importance of in vitro morphological subtypes. PLoS One 9(9):e103988
5. Korkmaz T, Seber S, Basaran G (2016) Review of the current role of targeted therapies as maintenance therapies in first and second line treatment of epithelial ovarian cancer; In the light of completed trials. Crit Rev Oncol Hematol 98:180–188
6. Bagnato A, Rosano L (2012) Understanding and overcoming chemoresistance in ovarian cancer: emerging role of the endothe- lin axis. Curr Oncol 19(1):36–38
7. Koti M et al (2015) A distinct pre-existing inflammatory tumour microenvironment is associated with chemotherapy resistance in high-grade serous epithelial ovarian cancer. Br J Cancer 113(12):1746
8. Crusz SM, Balkwill FR (2015) Inflammation and cancer: advances and new agents. Nat Rev Clin Oncol 12(10):584–596
9. Vyas D, Laput G, Vyas AK (2014) Chemotherapy-enhanced inflammation may lead to the failure of therapy and metastasis. Onco Targets Ther 7:1015–1023
10. Sato Y et al (2009) Cancer cells expressing toll-like recep- tors and the tumor microenvironment. Cancer Microenviron 2(1):205–214
11. Mai CW, Kang YB, Pichika MR (2013) Should a Toll-like recep- tor 4 (TLR-4) agonist or antagonist be designed to treat cancer? TLR-4: its expression and effects in the ten most common cancers. OncoTargets Ther 6:1573
12. Szajnik M et al (2009) TLR4 signaling induced by lipopolysaccha- ride or paclitaxel regulates tumor survival and chemoresistance in ovarian cancer. Oncogene 28(49):4353
13. Yamada Y et al (2011) New insights into pattern recognition receptors and their ligands in gynecologic pathologies. Hum Immunol 72(3):213–218
14. Coffelt SB, Scandurro AB (2008) Tumors sound the alarmin (s). Cancer Res 68(16):6482–6485
15. Chan JK et al (2012) Alarmins: awaiting a clinical response. J Clin Investig 122(8):2711–2719
16. Ran S (2015) The role of TLR4 in chemotherapy-driven metasta- sis. Cancer Res 75(12):2405–2410
17. Doyle SE et al (2002) IRF3 mediates a TLR3/TLR4-specific anti- viral gene program. Immunity 17(3):251–263
18. Vaure C, Liu Y (2014) A comparative review of toll-like receptor 4 expression and functionality in different animal species. Front Immunol 5:316
19. Brown J et al (2011) TLR-signaling networks: an integra- tion of adaptor molecules, kinases, and cross-talk. J Dent Res 90(4):417–427
20. Rajput S, Volk-Draper LD, Ran S (2013) TLR4 is a novel deter- minant of the response to paclitaxel in breast cancer. Mol Cancer Ther 12(8):1676–1687
21. Kawamoto T et al (2008) TAK-242 selectively suppresses Toll- like receptor 4-signaling mediated by the intracellular domain. Eur J Pharmacol 584(1):40–48
22. Ii M et al (2006) A novel cyclohexene derivative, ethyl (6R)-6-[N- (2-Chloro-4-fluorophenyl) sulfamoyl] cyclohex-1-ene-1-carboxy- late (TAK-242), selectively inhibits toll-like receptor 4-mediated cytokine production through suppression of intracellular signal- ing. Mol Pharmacol 69(4):1288–1295
23. Matsunaga N et al (2011) TAK-242 (resatorvid), a small-molecule inhibitor of Toll-like receptor (TLR) 4 signaling, binds selectively to TLR4 and interferes with interactions between TLR4 and its adaptor molecules. Mol Pharmacol 79(1):34–41
24. Takashima K et al (2009) Analysis of binding site for the novel small-molecule TLR4 signal transduction inhibitor TAK-242 and its therapeutic effect on mouse sepsis model. Br J Pharmacol 157(7):1250–1262
25. Seki H et al (2010) Effect of Toll-like receptor 4 inhibitor on LPS- induced lung injury. Inflamm Res 59(10):837–845
26. Fenhammar J et al (2011) Toll-like receptor 4 inhibitor TAK-242 attenuates acute kidney injury in endotoxemic sheep. Anesthesiol J Am Soc Anesthesiol 114(5):1130–1137
27. Li M et al (2017) TLR4 antagonist suppresses airway remodeling in asthma by inhibiting the T-helper 2 response. Exp Ther Med 14(4):2911–2916
28. Zhang Y et al (2015) TAK-242, a toll-like receptor 4 antagonist, protects against aldosterone-induced cardiac and renal injury. PLoS One 10(11):e0142456

29. Blohm-Mangone K et al (2018) Pharmacological TLR4 antagonism using topical resatorvid blocks solar UV-induced skin tumorigenesis in SKH-1 mice. Cancer Prev Res (Phila) 11(5):265–278
30. Abe T et al (1996) Inhibition of nucleolar function and morpho- logical change by adriamycin associated with heat shock protein 70 accumulation. Jpn J Cancer Res 87(9):945–951
31. Ohtsuboa T et al (2000) Enhancement of heat-induced heat shock protein (hsp) 72 accumulation by doxorubicin (Dox) in vitro. Cancer Lett 159(1):49–55
32. Gabrielson K et al (2007) Heat shock protein 90 and ErbB2 in the cardiac response to doxorubicin injury. Cancer Res 67(4):1436–1441
33. Nossov V et al (2008) The early detection of ovarian cancer: from traditional methods to proteomics. Can we really do better than serum CA-125? Am J Obstet Gynecol 199(3):215–223
34. Harper EI, Sheedy EF, Stack MS (2018) With great age comes great metastatic ability: ovarian cancer and the appeal of the aging peritoneal. microenvironment. Cancers 10(7):230
35. Lu YC, Yeh WC, Ohashi PS (2008) LPS/TLR4 signal transduc- tion pathway. Cytokine 42(2):145–151
36. Awasthi S (2014) Toll-like receptor-4 modulation for cancer immunotherapy. Front Immunol 5:328
37. Dey G et al (2017) Therapeutic implication of ‘Iturin A’ for targeting MD-2/TLR4 complex to overcome angiogenesis and invasion. Cell Signal 35:24–36
38. Zandi Z et al (2019) TLR4 blockade using TAK-242 suppresses ovarian and breast cancer cells invasion through the inhibition of extracellular matrix degradation and epithelial-mesenchymal transition. Eur J Pharmacol 853:256–263
39. Liu H et al (2016) Atractylenolide I modulates ovarian cancer cell-mediated immunosuppression by blocking MD-2/TLR4 complex-mediated MyD88/NF-κB signaling in vitro. J Trans Med 14(1):104
40. Chuffa LGA et al (2015) Melatonin attenuates the TLR4-medi- ated inflammatory response through MyD88-and TRIF-depend- ent signaling pathways in an in vivo model of ovarian cancer. BMC Cancer 15(1):34
41. Lee Y et al (2012) Interleukin-8 and its receptor CXCR41 in the tumour microenvironment promote colon cancer growth, progression and metastasis. Br J Cancer 106(11):1833
42. Ara T, DeClerck YA (2010) Interleukin-6 in bone metastasis and cancer progression. Eur J Cancer 46(7):1223–1231
43. Arcangeletti MC et al (2013) Toll-like receptor 4 is involved in the cell cycle modulation and required for effective human cytomegalovirus infection in THP-1 macrophages. Virology 440(1):19–30
44. Wang Y et al (2015) Downregulation of toll-like receptor 4 induces suppressive effects on hepatitis B virus-related hepato- cellular carcinoma via ERK1/2 signaling. BMC Cancer 15:821
45. Hasan UA, Trinchieri G, Vlach J (2005) Toll-like receptor sign- aling stimulates cell cycle entry and progression in fibroblasts. J Biol Chem 280(21):20620–20627
46. Dattaroy D et al (2018) Sparstolonin B (SsnB) attenuates liver fibrosis via a parallel conjugate pathway involving P53-P21 axis, TGF-beta signaling and focal adhesion that is TLR4 dependent. Eur J Pharmacol 841:33–48
47. Yang C-R et al (2000) Coordinate modulation of Sp1, NF-kappa B, and p53 in confluent human malignant melanoma cells after ionizing radiation. FASEB J 14(2):379–390
48. Momeny M et al (2018) Blockade of nuclear factor-κB (NF-κB) pathway inhibits growth and induces apoptosis in chemoresistant ovarian carcinoma cells. Int J Biochem Cell Biol 99:1–9
49. Wang Y et al (2012) Clusterin confers resistance to TNF-alpha- induced apoptosis in breast cancer cells through NF-kappaB acti- vation and Bcl-2 overexpression. J Chemother 24(6):348–357

50. Kim J et al (2010) TNF-α-induced ROS production triggering apoptosis is directly linked to Romo1 and Bcl-X L. Cell Death Differ 17(9):1420
51. Jones VS et al (2016) Cytokines in cancer drug resistance: cues to Resatorvid new therapeutic strategies. Biochim Biophys Acta 1865(2):255–265
Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.